Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 1194238
End position: 1194267
Length: 30

DNA sequence
>NC_011094, from 1194238 to 1194267 (30 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 ACGAAAAATAACCAGAAATAACAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1193298-1194452	Sequence	SeSA_A1216 mdoC glucans biosynthesis protein (Protein is coded in complementary strand; from 1194452 to 1193298)