Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633
Start position: 1120268
End position: 1120291
Length: 24

DNA sequence
>NC_011094, from 1120268 to 1120291 (24 bp); Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 CCGGAGCCGGAGCCGGTGCCGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1119853-1120962	Sequence	SeSA_A1133 ompA outer membrane protein A (Protein is coded in complementary strand; from 1120962 to 1119853)