Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 882272
End position: 882295
Length: 24

DNA sequence
>NC_011000, from 882272 to 882295 (24 bp); Burkholderia cenocepacia J2315 CTTGTCCTTTTCCTTGTGGTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 882066-882425	Sequence	BCAL0812 - sigma-54 modulation protein (Protein is coded in complementary strand; from 882425 to 882066)