Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 684226
End position: 684252
Length: 27

DNA sequence
>NC_011000, from 684226 to 684252 (27 bp); Burkholderia cenocepacia J2315 CGAGCCGCGCGAGCAGCGCGCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 684189-684395	Sequence	BCAL0629a - hypothetical protein (Protein is coded in complementary strand; from 684395 to 684189)