Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 554390
End position: 554413
Length: 24

DNA sequence
>NC_011000, from 554390 to 554413 (24 bp); Burkholderia cenocepacia J2315 TGATCGTGATCATGGTCGTGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 554012-555091	Sequence	BCAL0503 - putative cobalamin synthesis protein (Protein is coded in complementary strand; from 555091 to 554012)