Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 3768811
End position: 3768834
Length: 24

DNA sequence
>NC_011000, from 3768811 to 3768834 (24 bp); Burkholderia cenocepacia J2315 CCGCCGCGGCCGCCGTCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3767827-3768939	Sequence	BCAL3440 obgE GTPase ObgE (Protein is coded in complementary strand; from 3768939 to 3767827)