Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 3123395
End position: 3123421
Length: 27

DNA sequence
>NC_011000, from 3123395 to 3123421 (27 bp); Burkholderia cenocepacia J2315 GCCGCGAGCGCGGCGAGCACCGCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3123311-3124066	Sequence	BCAL2843 - putative branched-chain amino acid transport protein (Protein is coded in complementary strand; from 3124066 to 3123311)