Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2993543
End position: 2993567
Length: 25

DNA sequence
>NC_011000, from 2993543 to 2993567 (25 bp); Burkholderia cenocepacia J2315 GCCACGCAACGCAACGCCGCGCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2993139-2994350	Sequence	BCAL2726 dfp bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase