Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2948041
End position: 2948065
Length: 25

DNA sequence
>NC_011000, from 2948041 to 2948065 (25 bp); Burkholderia cenocepacia J2315 ACGCGACGCTGCGCGACACGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2947710-2948459	Sequence	BCAL2680 - uroporphyrin-III C-methyltransferase (Protein is coded in complementary strand; from 2948459 to 2947710)