Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2731972
End position: 2732016
Length: 45

DNA sequence
>NC_011000, from 2731972 to 2732016 (45 bp); Burkholderia cenocepacia J2315 CGGCGGCTGATAGGCCGGCGCCTGGTACGCGGGTGCCTGATAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2731808-2732245	Sequence	BCAL2468 - hypothetical protein (Protein is coded in complementary strand; from 2732245 to 2731808)