Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2672031
End position: 2672066
Length: 36

DNA sequence
>NC_011000, from 2672031 to 2672066 (36 bp); Burkholderia cenocepacia J2315 CCGCGCTCACCGCCACGCTCCCCGCCGCGCTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2671767-2673251	Sequence	BCAL2412 rhlE2 putative ATP-dependent RNA helicase 2 (Protein is coded in complementary strand; from 2673251 to 2671767)