Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2585277
End position: 2585303
Length: 27

DNA sequence
>NC_011000, from 2585277 to 2585303 (27 bp); Burkholderia cenocepacia J2315 CGGCGATCACGACGATCACGGTGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2584097-2585587	Sequence	BCAL2332 nuoM NADH dehydrogenase subunit M (Protein is coded in complementary strand; from 2585587 to 2584097)