Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2491520
End position: 2491544
Length: 25

DNA sequence
>NC_011000, from 2491520 to 2491544 (25 bp); Burkholderia cenocepacia J2315 GCGCCGCGTCGAGCCACGCCGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2491483-2492238	Sequence	BCAL2248 - 4'-phosphopantetheinyl transferase superfamily protein (Protein is coded in complementary strand; from 2492238 to 2491483)