Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2256547
End position: 2256591
Length: 45

DNA sequence
>NC_011000, from 2256547 to 2256591 (45 bp); Burkholderia cenocepacia J2315 CCGCAGGCGCCGCGTGCGCGGGGGCCGCGTGCGCGGGGGCCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2255931-2257175	Sequence	BCAL2047 - major facilitator superfamily protein (Protein is coded in complementary strand; from 2257175 to 2255931)