Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2070885
End position: 2070908
Length: 24

DNA sequence
>NC_011000, from 2070885 to 2070908 (24 bp); Burkholderia cenocepacia J2315 AGCACGAGCCCGAGCACCATCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2070867-2071058	Sequence	BCAL1875 - hypothetical protein (Protein is coded in complementary strand; from 2071058 to 2070867)