Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 205661
End position: 205684
Length: 24

DNA sequence
>NC_011000, from 205661 to 205684 (24 bp); Burkholderia cenocepacia J2315 GCCGGCACCGGCGCCTGCGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 204567-205964	Sequence	BCAL0183 gudD putative glucarate dehydratase (Protein is coded in complementary strand; from 205964 to 204567)