Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 2037485
End position: 2037511
Length: 27

DNA sequence
>NC_011000, from 2037485 to 2037511 (27 bp); Burkholderia cenocepacia J2315 GACGCACCCGACGCAGCCGACGCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2035970-2038282	Sequence	BCAL1845 - hypothetical protein (Protein is coded in complementary strand; from 2038282 to 2035970)