Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 1939722
End position: 1939749
Length: 28

DNA sequence
>NC_011000, from 1939722 to 1939749 (28 bp); Burkholderia cenocepacia J2315 CGCCGCGCGCCACGCGCCGAGCGACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1939405-1940088	Sequence	BCAL1757 - hypothetical protein (Protein is coded in complementary strand; from 1940088 to 1939405)