Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 1573926
End position: 1573949
Length: 24

DNA sequence
>NC_011000, from 1573926 to 1573949 (24 bp); Burkholderia cenocepacia J2315 CTTCAGCGCTTCAACGCTTCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1573945-1574763	Sequence	BCAL1427 - myo-inositol catabolism protein (Protein is coded in complementary strand; from 1574763 to 1573945)