Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 1217908
End position: 1217931
Length: 24

DNA sequence
>NC_011000, from 1217908 to 1217931 (24 bp); Burkholderia cenocepacia J2315 CGCGAGCGCGCGCGCCAGCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1217339-1218370	Sequence	BCAL1113 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 1218370 to 1217339)