Sequence retrieval

Genome: Burkholderia cenocepacia J2315
Start position: 1170521
End position: 1170560
Length: 40

DNA sequence
>NC_011000, from 1170521 to 1170560 (40 bp); Burkholderia cenocepacia J2315 CTCGCCGCTACTCGCCGCTACTTGCCGTTACTCGCCGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1170559-1173867	Sequence	BCAL1079 mdtC multidrug resistance protein MdtC (Protein is coded in complementary strand; from 1173867 to 1170559)