Sequence retrieval

Genome: Brucella abortus S19
Start position: 86796
End position: 86827
Length: 32

DNA sequence
>NC_010742, from 86796 to 86827 (32 bp); Brucella abortus S19 ACTGCCCTACTGCCCTACTGCCCTACTGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 86819-87202	Sequence	BAbS19_I00720 - hypothetical protein (Protein is coded in complementary strand; from 87202 to 86819)