Sequence retrieval

Genome: Brucella abortus S19
Start position: 866772
End position: 866795
Length: 24

DNA sequence
>NC_010742, from 866772 to 866795 (24 bp); Brucella abortus S19 GCGCGGGCGCTGGCGCGCGCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 866524-867732	Sequence	BAbS19_I08350 - deoxyguanosinetriphosphate triphosphohydrolase-like protein