Sequence retrieval

Genome: Brucella abortus S19
Start position: 756396
End position: 756435
Length: 40

DNA sequence
>NC_010742, from 756396 to 756435 (40 bp); Brucella abortus S19 TCCCTTACTCCCTTACTCCCTTACTCCCTTACTCCCTTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 756433-757590	Sequence	BAbS19_I07230 - Rnd, ribonuclease D (Protein is coded in complementary strand; from 757590 to 756433)