Sequence retrieval

Genome: Brucella abortus S19
Start position: 568637
End position: 568660
Length: 24

DNA sequence
>NC_010742, from 568637 to 568660 (24 bp); Brucella abortus S19 TGCCCTACTGCCTTACTGCCCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 568642-570324	Sequence	BAbS19_I05380 - choline dehydrogenase (Protein is coded in complementary strand; from 570324 to 568642)