Sequence retrieval

Genome: Brucella abortus S19
Start position: 38258
End position: 38289
Length: 32

DNA sequence
>NC_010742, from 38258 to 38289 (32 bp); Brucella abortus S19 TAAGGGAGTAAGGGAATAGGGGAGTAAGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 37647-38345	Sequence	BAbS19_I00280 recR recombination protein RecR (Protein is coded in complementary strand; from 38345 to 37647)