Sequence retrieval

Genome: Brucella abortus S19
Start position: 37529
End position: 37564
Length: 36

DNA sequence
>NC_010742, from 37529 to 37564 (36 bp); Brucella abortus S19 AATGGCGGGAGAAAGGGCGGGAGAAATGGCCAGAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 36348-37631	Sequence	BAbS19_I00270 - transglycosylase (Protein is coded in complementary strand; from 37631 to 36348)