Sequence retrieval

Genome: Brucella abortus S19
Start position: 28818
End position: 28841
Length: 24

DNA sequence
>NC_010742, from 28818 to 28841 (24 bp); Brucella abortus S19 TCTTCCTCTTCGGCTTCCTCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 28608-28991	Sequence	BAbS19_I00210 - hypothetical protein (Protein is coded in complementary strand; from 28991 to 28608)