Sequence retrieval

Genome: Brucella abortus S19
Start position: 1974941
End position: 1974976
Length: 36

DNA sequence
>NC_010742, from 1974941 to 1974976 (36 bp); Brucella abortus S19 TGATCGTTATGATGATCGTGATGGTGATCGTGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1974536-1975708	Sequence	BAbS19_I19070 - ATP/GTP-binding protein (Protein is coded in complementary strand; from 1975708 to 1974536)