Sequence retrieval

Genome: Brucella abortus S19
Start position: 1714160
End position: 1714204
Length: 45

DNA sequence
>NC_010742, from 1714160 to 1714204 (45 bp); Brucella abortus S19 TGGCCGCGATTCTGGTTGCCACGATGCTGGTTTCCACGATTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1713878-1716964	Sequence	BAbS19_I16640 - ATP-dependent helicase (Protein is coded in complementary strand; from 1716964 to 1713878)