Sequence retrieval

Genome: Brucella abortus S19
Start position: 1500252
End position: 1500275
Length: 24

DNA sequence
>NC_010742, from 1500252 to 1500275 (24 bp); Brucella abortus S19 CCGGCTCCGCCTCCGGCTTCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1499696-1501381	Sequence	BAbS19_I14490 - ATP/GTP-binding protein (Protein is coded in complementary strand; from 1501381 to 1499696)