Sequence retrieval

Genome: Brucella abortus S19
Start position: 1231317
End position: 1231352
Length: 36

DNA sequence
>NC_010742, from 1231317 to 1231352 (36 bp); Brucella abortus S19 GCGGCAGCAGCAGGGGCAGCGCCACCGGCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1231098-1231472	Sequence	BAbS19_I11800 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1231472 to 1231098)