Sequence retrieval

Genome: Brucella abortus S19
Start position: 1039431
End position: 1039457
Length: 27

DNA sequence
>NC_010742, from 1039431 to 1039457 (27 bp); Brucella abortus S19 CCGCATCGGCCGCACCGGCCGCAACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1038185-1039780	Sequence	BAbS19_I09940 - ATP-dependent RNA helicase, DEAD/DEAH box family