Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1929989
End position: 1930042
Length: 54

DNA sequence
>NC_010682, from 1929989 to 1930042 (54 bp); Ralstonia pickettii 12J GTCCATGCCAGACATGCCAGACATGCCAGACATGCCAGACATGCCAGACATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1929390-1931204	Sequence	Rpic_1840 - copper-resistance protein (Protein is coded in complementary strand; from 1931204 to 1929390)