Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 3867682
End position: 3867726
Length: 45

DNA sequence
>NC_010682, from 3867682 to 3867726 (45 bp); Ralstonia pickettii 12J GCGCCAGCACCAGCAGCGGCAGCACATGCAGCGCCTGCGACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3867519-3868031	Sequence	Rpic_3688 - rod shape-determining protein MreD (Protein is coded in complementary strand; from 3868031 to 3867519)