Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 503867
End position: 503902
Length: 36

DNA sequence
>NC_010682, from 503867 to 503902 (36 bp); Ralstonia pickettii 12J GCCATCGCGGCCATCGCGGCCATCGCGGCCATCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 502392-503987	Sequence	Rpic_0469 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 503987 to 502392)