Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 257069
End position: 257104
Length: 36

DNA sequence
>NC_010682, from 257069 to 257104 (36 bp); Ralstonia pickettii 12J GCGCGGCTTCGGGCGCCGCTGCGGGCGTGGGTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 255967-257151	Sequence	Rpic_0241 - signal recognition particle-docking protein FtsY (Protein is coded in complementary strand; from 257151 to 255967)