Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 3917341
End position: 3917370
Length: 30

DNA sequence
>NC_010682, from 3917341 to 3917370 (30 bp); Ralstonia pickettii 12J GGTGCGGCGCGCGGCGGCGCAGTACGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3916884-3917720	Sequence	Rpic_3737 - winged helix family two component transcriptional regulator (Protein is coded in complementary strand; from 3917720 to 3916884)