Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2684091
End position: 2684120
Length: 30

DNA sequence
>NC_010682, from 2684091 to 2684120 (30 bp); Ralstonia pickettii 12J AGCGCGCAGCAGCACGCGGCGGCGCGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2683567-2684172	Sequence	Rpic_2574 - hypothetical protein (Protein is coded in complementary strand; from 2684172 to 2683567)