Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2593828
End position: 2593857
Length: 30

DNA sequence
>NC_010682, from 2593828 to 2593857 (30 bp); Ralstonia pickettii 12J GGTGCCGGAGCCGCTGCCGGTGCGGATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2593693-2593917	Sequence	Rpic_2479 - signal peptide protein (Protein is coded in complementary strand; from 2593917 to 2593693)