Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2468020
End position: 2468049
Length: 30

DNA sequence
>NC_010682, from 2468020 to 2468049 (30 bp); Ralstonia pickettii 12J GCGCGGCTCGGCGCGACGCGGCGTGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2467832-2468479	Sequence	Rpic_2374 - allophanate hydrolase subunit 1 (Protein is coded in complementary strand; from 2468479 to 2467832)