Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1226589
End position: 1226618
Length: 30

DNA sequence
>NC_010682, from 1226589 to 1226618 (30 bp); Ralstonia pickettii 12J CCTGCCAGCGCCTGCCAGGACGTGCCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1220370-1228040	Sequence	Rpic_1146 - Beta-ketoacyl synthase (Protein is coded in complementary strand; from 1228040 to 1220370)