Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 814332
End position: 814358
Length: 27

DNA sequence
>NC_010682, from 814332 to 814358 (27 bp); Ralstonia pickettii 12J CCGGAGCAGCCGGAGCAGCCGGAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 813941-814597	Sequence	Rpic_0770 - OmpA/MotB domain-containing protein (Protein is coded in complementary strand; from 814597 to 813941)