Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 495532
End position: 495558
Length: 27

DNA sequence
>NC_010682, from 495532 to 495558 (27 bp); Ralstonia pickettii 12J GATCACCAGGATCACCAGGATCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 495263-496966	Sequence	Rpic_0463 - major facilitator superfamily protein (Protein is coded in complementary strand; from 496966 to 495263)