Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 3898963
End position: 3898989
Length: 27

DNA sequence
>NC_010682, from 3898963 to 3898989 (27 bp); Ralstonia pickettii 12J CTGCTGCCACTGCTGCCACTGCGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3897768-3899291	Sequence	Rpic_3720 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 3899291 to 3897768)