Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 37138
End position: 37164
Length: 27

DNA sequence
>NC_010682, from 37138 to 37164 (27 bp); Ralstonia pickettii 12J CGTGTTGCCCGTGTTGACCGTGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 36686-38254	Sequence	Rpic_0025 - 40-residue YVTN family beta-propeller repeat-containing protein (Protein is coded in complementary strand; from 38254 to 36686)