Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 3581465
End position: 3581491
Length: 27

DNA sequence
>NC_010682, from 3581465 to 3581491 (27 bp); Ralstonia pickettii 12J CAGCCACATCGGCCACATCGGCCACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3578763-3581540	Sequence	Rpic_3413 - hypothetical protein (Protein is coded in complementary strand; from 3581540 to 3578763)