Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2383285
End position: 2383311
Length: 27

DNA sequence
>NC_010682, from 2383285 to 2383311 (27 bp); Ralstonia pickettii 12J CGGCCCCCACGGGCCCCAAGGCCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2383022-2383690	Sequence	Rpic_2264 - putative transmembrane lipoprotein (Protein is coded in complementary strand; from 2383690 to 2383022)