Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 2207945
End position: 2207971
Length: 27

DNA sequence
>NC_010682, from 2207945 to 2207971 (27 bp); Ralstonia pickettii 12J CAGAACGCCGAGAACGCCCAGCACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2207007-2208569	Sequence	Rpic_2095 - methyl-accepting chemotaxis sensory transducer