Sequence retrieval

Genome: Ralstonia pickettii 12J
Start position: 1063647
End position: 1063673
Length: 27

DNA sequence
>NC_010682, from 1063647 to 1063673 (27 bp); Ralstonia pickettii 12J GCGGTGGCTGCCGTGGCTGCGGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1063146-1063727	Sequence	Rpic_1006 - cyclophilin type peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 1063727 to 1063146)